Write the sequence of the primary rna transcript

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.

Order a similar paper and get 15% discount. Use the coupon code GILB

Dr. Padma Myers
Dr. Padma Myers
98% Success Rate
Read More
“Hello, I deliver nursing papers on time following instructions from the client. My primary goal is customer satisfaction. Welcome for plagiarism free papers”
Stern Frea
Stern Frea
98% Success Rate
Read More
Hi! I am an English Language and Literature graduate; I have written many academic essays, including argumentative essays, research papers, and literary analysis.
Dr. Ishid Elsa
Dr. Ishid Elsa
98% Success Rate
Read More
"Hi, count on me to deliver quality papers that meet your expectations. I write well researched papers in the fields of nursing and medicine".
Dr. Paul P. Klug
Dr. Paul P. Klug
99% Success Rate
Read More
"A top writer with proven reliability and experience. I have a 99% success rate, overall rating of 10. Hire me for quality custom written nursing papers. Thank you"

How Our Essay Writing Service Works

Tell Us Your Requirements

Fill out order details and instructions, then upload any files or additional materials if needed. Then, confirm your order by clicking “Place an Order.”

Make your payment

Your payment is processed by a secure system. We accept Mastercard, Visa, Amex, and Discover. We don’t share any informati.on with third parties

The Writing Process

You can communicate with your writer. Clarify or track order with our customer support team. Upload all the necessary files for the writer to use.

Download your paper

Check your paper on your client profile. If it meets your requirements, approve and download. If any changes are needed, request a revision to be done.

Recent Questions

Stay In Touch!

Leave your email and get discount promo codes and the best essay samples from our writers!